python - Find number of breaks in a sequence -

-

i have program parsing allele sequences. trying write code determines if allele complete or not. so, need count number of breaks in reference sequence. break signified string of '-'. if there more 1 break want program "incomplete allele."

how can figure out how count number of breaks in sequence?

here example of "broken" sequence:

>dqb1*04:02:01 ------------------------------------------------------------ ------------------------------------------------------------ ------------------------------------------------------------ --atgtcttggaagaaggctttgcggat-------ccctggaggccttcgggtagcaact gtgacctt----gatgctggcgatgctgagcaccccggtggctgagggcagagactctcc cgaggatttcgtgttccagtttaagggcatgtgctacttcaccaacgggaccgagcgcgt gcggggtgtgaccagatacatctataaccgagaggagtacgcgcgcttcgacagcgacgt gggggtgtatcgggcggtgacgccgctggggcggcttgacgccgagtactggaatagcca gaaggacatcctggaggaggaccgggcgtcggtggacaccgtatgcagacacaactacca gttggagctccgcacgaccttgcagcggcga----------------------------- ----------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------------------ ---gtggagcccacagtgaccatctccccatccaggacagaggccctcaaccaccacaac ctgctggtctgctcagtgacagatttctatccagcccagatcaaagtccggtggtttcgg aatgaccaggaggagacaactggcgttgtgtccaccccccttattaggaacggtgactgg accttccagatcctggtgatgctggaaatgactccccagcgtggagacgtctacacctgc cacgtggagcaccccagcctccagaaccccatcatcgtggagtggcgggctcagtctgaa tctgcccagagcaagatgctgagtgg----cattggaggcttcgtgctggggctgatctt cctcgggctgggccttattatc--------------catcacaggagtcagaaagggctc ctgcactga--------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------------------ ------------------------------------------------------------

the code have far follows:

idx=[] m in range(len(sequence)):     n in re.finditer('-',sequence[0]):          idx.append(n.start()) counter=0 min_val=[] n in range(len(idx)):     if counter==idx[n]:         counter=counter+1     elif counter !=0:         min_val.append(idx[n-1])         counter=0

my reasoning above code if find start positions of '-' can see how many times appear within sequence , if break sequence @ all. however, know there flaws in above code.

it seems can count occurrances of -+, i.e. sequence of one or more - symbols. problem line breaks, either incorporate regex, or split , join string before matching.

>>> sequence = """>dqb1*04:02:01.....""" >>> joined = ''.join(sequence.splitlines()) >>> sum(1 m in re.finditer("-+", joined)) 7

note: includes - @ start , end of sequence.

or reverse approach: instead of counting gaps, count groups:

>>> sum(1 m in re.finditer("[gatc]+", joined)) 6

Comments

Post a Comment

Popular posts from this blog

Spring Boot + JPA + Hibernate: Unable to locate persister -

-
i trying work entity inside request method of spring boot application. entity in project , pom.xml has dependencies it. why error message?: org.hibernate.unknownentitytypeexception: unable locate persister: com.ric.bill.model.bs.par package com.ric.web; import java.util.concurrent.atomic.atomiclong; import javax.persistence.entitymanager; import javax.persistence.persistencecontext; import net.sf.ehcache.cachemanager; import net.sf.ehcache.management.cache; import net.sf.ehcache.management.cachestatistics; import org.hibernate.stat.statistics; import org.springframework.beans.factory.annotation.autowired; import org.springframework.boot.autoconfigure.domain.entityscan; import org.springframework.cache.annotation.enablecaching; import org.springframework.transaction.annotation.enabletransactionmanagement; import org.springframework.transaction.annotation.propagation; import org.springframework.transaction.annotation.transactional; import org.springframework.web.bind.annotati
Read more

go - Golang: panic: runtime error: invalid memory address or nil pointer dereference using bufio.Scanner -

-
i implementing go program uses bufio.scanner , bufio.writer have packaged code follows package main import ( "fmt" "player/command" "strings" ) func main() { //enter code here. read input stdin. print output stdout commands.scanner.scan() { //scan new line , send comand variable check command exist or not input := strings.split(strings.trim(commands.scanner.text(), " "), " ") command := input[0] if command == "" { fmt.printf("$ %s:", commands.pwd) continue } if !commands.commands[command] { commands.throwerror("cannot recognize input.") } else { commands.execute(command, input[1:], nil) } fmt.printf("$ %s:", commands.pwd) } } i using init.go file in main package follows package main import ( "flag" "player/sourc
Read more

c - double free or corruption (fasttop) -

-
this code reads null terminated string file (file containing null terminated strings & should provide index wanted string). error: *** error in `./main': double free or corruption (fasttop): 0x090a4a80 *** aborted code: char *tmp_realloc=null; char *sstring=null; int i=1; /*set file pointer point string*/ fseek(fh,index,seek_set); sstring=(char*)malloc(sizeof(char)); if(sstring == null) return null; tmp_realloc=sstring; while( (*(sstring+i-1)=(char)fgetc((file*)fh)) != 0x0 ) { /*reallocate more memory*/ tmp_realloc=(char*)realloc((char*)sstring,++i); /*if not same address copy old new & set old point new*/ if(tmp_realloc != sstring){ strcpy((char*)tmp_realloc,(char*)sstring); free(sstring); sstring=tmp_realloc; } } could tell me pointer causing issue (& reason) ? remove part /*if not same address copy old new & set old point new*/ if(tmp_realloc != sstring){ strc
Read more